Stem-loop sequence bra-MIR400

AccessionMI0030567 (change log)
DescriptionBrassica rapa miR400 stem-loop
Literature search

3 open access papers mention bra-MIR400
(6 sentences)

Stem-loop
   auc           ag    u        u         g              g a     uaauc   u 
5'    uuuucuugaga  uugc gaagauug uuuaugaga uauuauaagucacu c uuugg     aag g
      |||||||||||  |||| |||||||| ||||||||| |||||||||||||| | |||||     ||| u
3'    gagagaauucu  aacg uuuuuagc aaguacucu guaauauucaguga g aaacc     uuc u
   aau           ga    -        u         a              a c     ---cu   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 20034113-20034253 [-]
intergenic
Database links

Mature sequence bra-miR400-5p

Accession MIMAT0035856
Sequence

33 - 

uaugagaguauuauaagucac

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR400-3p

Accession MIMAT0035857
Sequence

92 - 

gacuuauaaugaucucaugaa

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1