Stem-loop sequence bra-MIR398

AccessionMI0030566 (change log)
DescriptionBrassica rapa miR398 stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention bra-MIR398
(10 sentences)

Stem-loop
   ----gu   c    a     uc   a             uaauc     c  ----------          
5'       gga cucg caggg  gac ugagaacacaugg     aaaga ug          uaaugacgc 
         ||| |||| |||||  ||| |||||||||||||     ||||| ||          |||||||| c
3'       ucu gagu guccc  cug acucuuguguacu     uuucu ac          guuacugca 
   ucucuu   c    c     ca   g             -----     c  uacauacaau          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 2736128-2736251 [+]
intergenic
Database links

Mature sequence bra-miR398-5p

Accession MIMAT0035854
Sequence

14 - 

gggucgacaugagaacacaug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR398-3p

Accession MIMAT0035855
Sequence

89 - 

uguguucucaggucaccccug

 - 109

Get sequence
Evidence experimental; Illumina [1]

References

1