Stem-loop sequence bra-MIR396

AccessionMI0030565 (change log)
DescriptionBrassica rapa miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention bra-MIR396
(13 sentences)

Stem-loop
   cau          ----     a                    a    -c      --auuucccuu  u      ccaaaau 
5'    gaagauccug    guuau uuuuuccacagcuuucuuga cuuu  uuuuuc           au uuagag       a
      ||||||||||    ||||| |||||||||||||||||||| ||||  ||||||           || ||||||       a
3'    cuuuugggac    cagua aaaagggugucgaaagaacu gaaa  aaaaag           ua aaucuc       c
   cuu          uuaa     c                    c    aa      aucucacaauu  c      uaaaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 8319788-8319949 [-]
intergenic
Database links

Mature sequence bra-miR396-5p

Accession MIMAT0035852
Sequence

23 - 

uuccacagcuuucuugaacuu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR396-3p

Accession MIMAT0035853
Sequence

118 - 

gcucaagaaagcugugggaaa

 - 138

Get sequence
Evidence experimental; Illumina [1]

References

1