Stem-loop sequence bra-MIR395a

AccessionMI0030564 (change log)
DescriptionBrassica rapa miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bra-MIR395a
(16 sentences)

Stem-loop
      uc   ua         ug         u      uacaa    u 
5' aug  ucc  gaguuccuc  agcacuuca ugggua     uuuc u
   |||  |||  |||||||||  ||||||||| ||||||     ||||  
3' uac  agg  cucaagggg  uugugaagu acccau     gaag a
      cc   uc         gu         c      ---ua    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 17814983-17815075 [-]
intergenic
Database links

Mature sequence bra-miR395a-5p

Accession MIMAT0035850
Sequence

13 - 

guuccucugagcacuucauug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR395a-3p

Accession MIMAT0035851
Sequence

63 - 

cugaaguguuugggggaacuc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1