Stem-loop sequence bra-MIR395c

AccessionMI0030563 (change log)
DescriptionBrassica rapa miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bra-MIR395c
(14 sentences)

Stem-loop
   gu      uu   ua         ug         u    uaua      uuucua 
5'   cggaug  ucc  gaguuccuc  agcacuuca ugga    acauuu      u
     ||||||  |||  |||||||||  ||||||||| ||||    ||||||       
3'   gcuuac  agg  cucaagggg  uugugaagu accu    uguaaa      c
   --      uc   uc         gu         c    --ua      uuaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA7: 18568920-18569029 [-]
intergenic
Clustered miRNAs
< 10kb from bra-MIR395c
bra-MIR395cchrA7: 18568920-18569029 [-]
bra-MIR395bchrA7: 18563029-18563122 [-]
Database links

Mature sequence bra-miR395c-5p

Accession MIMAT0035848
Sequence

18 - 

guuccucugagcacuucauug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR395c-3p

Accession MIMAT0035849
Sequence

77 - 

cugaaguguuugggggaacuc

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1