Stem-loop sequence bra-MIR395b

AccessionMI0030562 (change log)
DescriptionBrassica rapa miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

7 open access papers mention bra-MIR395b
(16 sentences)

Stem-loop
   auguu   ua         ug         u     a   c    auuu 
5'      ucc  gaguuccuc  agcacuuca uggag uac auuu    u
        |||  |||||||||  ||||||||| ||||| ||| ||||    c
3'      agg  cucaagggg  uugugaagu accuu aug uaaa    u
   -----   uc         gu         c     -   -    acua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA7: 18563029-18563122 [-]
intergenic
Clustered miRNAs
< 10kb from bra-MIR395b
bra-MIR395cchrA7: 18568920-18569029 [-]
bra-MIR395bchrA7: 18563029-18563122 [-]
Database links

Mature sequence bra-miR395b-5p

Accession MIMAT0035846
Sequence

13 - 

guuccucugagcacuucauug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR395b-3p

Accession MIMAT0035847
Sequence

69 - 

cugaaguguuugggggaacuc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1