Stem-loop sequence bra-MIR395d

AccessionMI0030561 (change log)
DescriptionBrassica rapa miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bra-MIR395d
(14 sentences)

Stem-loop
   gu      uu   ua         ug         u    uaua      u  au 
5'   cggaug  ucc  gaguuccuc  agcacuuca ugga    acauuu cu  c
     ||||||  |||  |||||||||  ||||||||| ||||    |||||| ||  a
3'   gcuuac  agg  cucaagggg  uugugaagu aucu    uguaaa ga  a
   --      uc   uc         gu         c    --ua      -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA2: 11572546-11572653 [-]
intergenic
Database links

Mature sequence bra-miR395d-5p

Accession MIMAT0035844
Sequence

18 - 

guuccucugagcacuucauug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR395d-3p

Accession MIMAT0035845
Sequence

75 - 

cugaaguguuugggggaacuc

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1