Stem-loop sequence bra-MIR391

AccessionMI0030560 (change log)
DescriptionBrassica rapa miR391 stem-loop
Literature search

2 open access papers mention bra-MIR391
(4 sentences)

Stem-loop
      a   -    uuc   u  c          g  c     -     --u  u 
5' gca aua aagg   gcu cg aggagagaua cg cauca cuucu   cu a
   ||| ||| ||||   ||| || |||||||||| || ||||| |||||   ||  
3' cgu uau uucc   cga gc uccucucuau gc guggu gaaga   ga a
      a   a    uaa   u  a          g  a     a     uuu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA10: 9284925-9285028 [+]
intergenic
chrA9: 35664790-35664893 [-]
intergenic
Database links

Mature sequence bra-miR391-5p

Accession MIMAT0035842
Sequence

17 - 

uucgcaggagagauagcgcca

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR391-3p

Accession MIMAT0035843
Sequence

69 - 

acgguaucucuccuacguagc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1