Stem-loop sequence bra-MIR390

AccessionMI0030559 (change log)
DescriptionBrassica rapa miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

6 open access papers mention bra-MIR390
(12 sentences)

Stem-loop
       --      au u  a          g           ucaug   aca 
5' guag  agaaga  c gu aagcucagga ggauagcgcca     auc   c
   ||||  ||||||  | || |||||||||| |||||||||||     |||   a
3' cauc  ucuucu  g ua uuugaguccu ccugucgcggu     uag   c
       au      cg u  c          a           uuuua   cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA4: 16514660-16514764 [+]
intergenic
Database links

Mature sequence bra-miR390-5p

Accession MIMAT0035840
Sequence

18 - 

aagcucaggagggauagcgcc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR390-3p

Accession MIMAT0035841
Sequence

68 - 

cgcuguccauccugaguuuca

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1