Stem-loop sequence bra-MIR319

AccessionMI0030558 (change log)
DescriptionBrassica rapa miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

9 open access papers mention bra-MIR319
(31 sentences)

Stem-loop
   uuguagggauauauauc     a          g      uu      cu  g u   a       a    -   ac    c   c  aa  c      --a  aaa 
5'                  gaggg gagcuuccuu agucca  cagagg  gu a aug uccaauu guuu ccg  ucau cau ca  ua cgaguu   cu   u
                    ||||| |||||||||| ||||||  ||||||  || | ||| ||||||| |||| |||  |||| ||| ||  || ||||||   ||    
3'                  cucuc cucgagggaa ucaggu  guuucu  ua u uac agguuaa caga ggc  agua gua gu  au gcucag   ga   u
   -------------uucu     c          g      ug      cu  g -   a       a    u   gu    a   a  aa  u      aua  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 7428122-7428320 [+]
intergenic
Database links

Mature sequence bra-miR319-5p

Accession MIMAT0035838
Sequence

23 - 

agagcuuccuugaguccauuc

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR319-3p

Accession MIMAT0035839
Sequence

172 - 

uuggacugaagggagcucccu

 - 192

Get sequence
Evidence experimental; Illumina [1]

References

1