Stem-loop sequence bra-MIR168a

AccessionMI0030557 (change log)
DescriptionBrassica rapa miR168a stem-loop
Gene family MIPF0000081; MIR168
Literature search

8 open access papers mention bra-MIR168a
(51 sentences)

Stem-loop
        g   c   u  c              u     a      --g   g   cc    --     c 
5' uuacg cgg cuc ga ucgcuuggugcagg cggga cugauu   gcu aca  gcca  cgugg u
   ||||| ||| ||| || |||||||||||||| ||||| ||||||   ||| |||  ||||  |||||  
3' agugc gcc gag cu agugaacuauguuc gcccu ggcuag   cga ugu  cggu  guacc u
        a   u   c  a              c     a      gga   g   -u    ug     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 25084101-25084233 [+]
intergenic
Database links

Mature sequence bra-miR168a-5p

Accession MIMAT0035836
Sequence

18 - 

ucgcuuggugcaggucgggaa

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR168a-3p

Accession MIMAT0035837
Sequence

98 - 

cccgccuuguaucaagugaau

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1