Stem-loop sequence bra-MIR168c

AccessionMI0030556 (change log)
DescriptionBrassica rapa miR168c stem-loop
Gene family MIPF0000081; MIR168
Literature search

8 open access papers mention bra-MIR168c
(42 sentences)

Stem-loop
   gaa       --c      g      c          u     ca   a  a  gg     --uu   u 
5'    ucaccgu   gggcuc gauucg uuggugcagg cggga  caa uc cu  ugcuu    gcc u
      |||||||   |||||| |||||| |||||||||| |||||  ||| || ||  |||||    ||| a
3'    aguggua   uccgag cuaagu aacuacguuc gcccu  guu ag gg  acgag    ugg u
   caa       acc      g      c          c     cg   -  -  --     uguu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 23668240-23668372 [+]
intergenic
Database links

Mature sequence bra-miR168c-5p

Accession MIMAT0035834
Sequence

22 - 

ucgcuuggugcaggucgggac

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR168c-3p

Accession MIMAT0035835
Sequence

92 - 

cccgccuugcaucaacugaau

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1