Stem-loop sequence bra-MIR168b

AccessionMI0030555 (change log)
DescriptionBrassica rapa miR168b stem-loop
Gene family MIPF0000081; MIR168
Literature search

8 open access papers mention bra-MIR168b
(42 sentences)

Stem-loop
   ------  -     g      c          u     -       g   -a     -   -cgu  a 
5'       cg ggcuc gauucg uuggugcagg cggga cuaauuc cug  cacag cca    gg u
         || ||||| |||||| |||||||||| ||||| ||||||| |||  ||||| |||    || u
3'       gc ccgag cuaagu aacuacguuc gcccu gguuagg gac  guguu ggu    cc u
   guggua  u     g      c          c     a       -   ga     u   uauu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 5387909-5388035 [+]
intergenic
Database links

Mature sequence bra-miR168b-5p

Accession MIMAT0035832
Sequence

12 - 

ucgcuuggugcaggucgggac

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR168b-3p

Accession MIMAT0035833
Sequence

91 - 

cccgccuugcaucaacugaau

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1