Stem-loop sequence bra-MIR162

AccessionMI0030554 (change log)
DescriptionBrassica rapa miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

6 open access papers mention bra-MIR162
(6 sentences)

Stem-loop
   u a   uu    u       g    c    c       a    c   gaaaa   -au    g 
5'  g aag  gaag cgcugga gcag gguu aucgauc auuc ugu     aug   guug a
    | |||  |||| ||||||| |||| |||| ||||||| |||| |||     |||   ||||  
3'  c uuc  cuuc gugaccu cguc ccaa uagcuag uaag acg     uac   uaac a
   u c   cu    -       a    u    a       c    u   aaggg   auu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 21022093-21022218 [+]
intergenic
Database links

Mature sequence bra-miR162-5p

Accession MIMAT0035830
Sequence

18 - 

ggaggcagcgguucaucgauc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR162-3p

Accession MIMAT0035831
Sequence

92 - 

ucgauaaaccucugcauccag

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1