Stem-loop sequence bra-MIR156g

AccessionMI0030553 (change log)
DescriptionBrassica rapa miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156g
(145 sentences)

Stem-loop
   ------c  aaa   a        -    -         a   ---     cuu     g 
5'        gc   gaa cugacaga agag agugagcac caa   aggca   ugcau u
          ||   ||| |||||||| |||| ||||||||| |||   |||||   ||||| u
3'        cg   cuu gacugucu ucuc ucacucgug guu   uucgu   acgua c
   uuagccu  -gc   a        a    g         c   cuc     -uu     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 2836909-2837018 [+]
intergenic
Database links

Mature sequence bra-miR156g-5p

Accession MIMAT0035828
Sequence

12 - 

ugacagaagagagugagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156g-3p

Accession MIMAT0035829
Sequence

75 - 

gcucacugcucuaucugucaga

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1