Stem-loop sequence bra-MIR156f

AccessionMI0030552 (change log)
DescriptionBrassica rapa miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156f
(145 sentences)

Stem-loop
   --------------uugugagugaaugagcuggggcaaaagaaacacacagaaa         -   -         a   ---        u   u 
5'                                                       cugacagaa gag agugagcac caa   aaguaaau gca a
                                                         ||||||||| ||| ||||||||| |||   |||||||| ||| u
3'                                                       gacugucuu cuc ucacucgug guu   uucguuua cgu g
   cucucugacucuguuucuccuuguuccuguccgguuucucuagucgugcccuua         u   g         c   cuc        -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 31078747-31078923 [+]
intergenic
Database links

Mature sequence bra-miR156f-5p

Accession MIMAT0035826
Sequence

42 - 

ugacagaagagagugagcac

 - 61

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156f-3p

Accession MIMAT0035827
Sequence

102 - 

ugcucacugcucuuucugucaga

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1