Stem-loop sequence bra-MIR156e

AccessionMI0030551 (change log)
DescriptionBrassica rapa miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156e
(145 sentences)

Stem-loop
   gaaaugcaaca     -------           -     -       u    ag   cu     gu 
5'            gagaa       aacugacagaa gagag ugagcac ugca  gca  guuau  g
              |||||       ||||||||||| ||||| ||||||| ||||  |||  |||||   
3'            cucuu       uugacugucuu cucuc acucgug gugu  cgu  caaua  u
   -------uucg     caguccg           u     c       c    -g   uu     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 13509380-13509498 [-]
intergenic
Database links

Mature sequence bra-miR156e-5p

Accession MIMAT0035824
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156e-3p

Accession MIMAT0035825
Sequence

80 - 

ugcucaccucucuuucugucagu

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1