Stem-loop sequence bra-MIR156d

AccessionMI0030550 (change log)
DescriptionBrassica rapa miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156d
(145 sentences)

Stem-loop
   -u         -                    ggcu   uu    auu  a 
5'   ggugacaga agagagugagcacacauggu    uuc  gcau   gg a
     ||||||||| ||||||||||||||||||||    |||  ||||   || g
3'   ccacugucu ucucucacucguguguaucg    aag  cgua   uc a
   cc         a                    ----   uu    --c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 17880586-17880682 [+]
intergenic
Clustered miRNAs
< 10kb from bra-MIR156d
bra-MIR156bchrA6: 17880337-17880458 [+]
bra-MIR156dchrA6: 17880586-17880682 [+]
Database links

Mature sequence bra-miR156d-5p

Accession MIMAT0035822
Sequence

4 - 

ugacagaagagagugagcac

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156d-3p

Accession MIMAT0035823
Sequence

75 - 

gcucacucucuaucugucacc

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1