Stem-loop sequence bra-MIR156c

AccessionMI0030549 (change log)
DescriptionBrassica rapa miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156c
(145 sentences)

Stem-loop
   c  aua   a        -    -         a   ---     cuu     g 
5'  gc   gaa cugacaga agag agugagcac caa   aggca   ugcau u
    ||   ||| |||||||| |||| ||||||||| |||   |||||   ||||| u
3'  cg   cuu gacugucu ucuc ucacucgug guu   uucgu   acgua c
   u  -gc   a        a    g         c   cuc     -uu     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 28490294-28490397 [-]
intergenic
Database links

Mature sequence bra-miR156c-5p

Accession MIMAT0035820
Sequence

12 - 

ugacagaagagagugagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156c-3p

Accession MIMAT0035821
Sequence

75 - 

gcucacugcucuaucugucaga

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1