Stem-loop sequence bra-MIR156b

AccessionMI0030548 (change log)
DescriptionBrassica rapa miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156b
(147 sentences)

Stem-loop
   gagugcu     auu a          -                    ggcu   uu    -  uug 
5'        gagga   g uggugacaga agagagugagcacacauggu    uuc  gcau au   a
          |||||   | |||||||||| ||||||||||||||||||||    |||  |||| ||    
3'        cucuu   c gccacugucu ucucucacucguguguaucg    aag  cgua ug   a
   -----cu     --c -          a                    ----   uu    c  uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 17880337-17880458 [+]
intergenic
Clustered miRNAs
< 10kb from bra-MIR156b
bra-MIR156bchrA6: 17880337-17880458 [+]
bra-MIR156dchrA6: 17880586-17880682 [+]
Database links

Mature sequence bra-miR156b-5p

Accession MIMAT0035818
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156b-3p

Accession MIMAT0035819
Sequence

92 - 

gcucacucucuaucugucacc

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1