Stem-loop sequence bra-MIR156a

AccessionMI0030547 (change log)
DescriptionBrassica rapa miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

16 open access papers mention bra-MIR156a
(159 sentences)

Stem-loop
   --aa  ua     a         -                    ggcu   uu     ---    uuu 
5'     gg  agggg ggugacaga agagagugagcacacauggu    uuc  gcaug   cuuu   c
       ||  ||||| ||||||||| ||||||||||||||||||||    |||  |||||   ||||    
3'     uc  ucuuc ccacugucu ucucucauucguguguaucg    aag  cguac   ggga   a
   ucuc  uc     c         c                    ----   uu     uuu    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA2: 2983764-2983891 [+]
intergenic
Database links

Mature sequence bra-miR156a-5p

Accession MIMAT0035816
Sequence

15 - 

ugacagaagagagugagcac

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR156a-3p

Accession MIMAT0035817
Sequence

94 - 

gcuuacucucucucugucacc

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1