Stem-loop sequence tae-MIR9674b

AccessionMI0030411 (change log)
DescriptionTriticum aestivum miR9674b stem-loop
Gene family MIPF0001917; MIR9674
Stem-loop
   -   c cg c          u     c     uuca  g    uugc 
5'  gaa u  u cauagcauca ccauc uaccc    ac gugg    c
    ||| |  | |||||||||| ||||| |||||    || ||||    g
3'  cuu a  a guaucguagu gguag auggg    ug cacc    a
   a   c au a          c     a     ----  g    ccuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9674b-5p

Accession MIMAT0035801
Sequence

11 - 

auagcaucauccauccuaccc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).