Stem-loop sequence tae-MIR9674b

AccessionMI0030411
DescriptionTriticum aestivum miR9674b stem-loop
Gene family MIPF0001917; MIR9674
Stem-loop
   -   c cg c          u     c     uuca  g    uugc 
5'  gaa u  u cauagcauca ccauc uaccc    ac gugg    c
    ||| |  | |||||||||| ||||| |||||    || ||||    g
3'  cuu a  a guaucguagu gguag auggg    ug cacc    a
   a   c au a          c     a     ----  g    ccuu 
Get sequence
Deep sequencing
12191 reads, 9.52e+03 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence tae-miR9674b-5p

Accession MIMAT0035801
Sequence

11 - 

auagcaucauccauccuaccc

 - 31

Get sequence
Deep sequencing7498 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).