Stem-loop sequence tae-MIR9675

AccessionMI0030408 (change log)
DescriptionTriticum aestivum miR9675 stem-loop
Literature search

2 open access papers mention tae-MIR9675
(5 sentences)

Stem-loop
   a  c  c   c                       c      a      uuggacacccaguccaggaacaugccgaggaguucagagcggagagguucaagggagcuugcaugg 
5'  ug ug cag caagacgagggugaucauaaacu cugggu aucaug                                                                  a
    || || ||| ||||||||||||||||||||||| |||||| ||||||                                                                   
3'  ac ac guc guuuugcucucacuaguauuuga gacccg uaguau                                                                  c
   -  u  u   c                       c      g      uugaggacgaaguccauguacgguaggaaaccagacgccgcacaugggcuucuuaugugguacuuu 
Get sequence
Deep sequencing
20111 reads, 81.9 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9675-3p

Accession MIMAT0035798
Sequence

199 - 

uuuaugaucacucucguuuug

 - 219

Get sequence
Deep sequencing16293 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).