Stem-loop sequence tae-MIR5384

AccessionMI0030407 (change log)
DescriptionTriticum aestivum miR5384 stem-loop
Literature search

1 open access papers mention tae-MIR5384
(1 sentences)

Stem-loop
   u     c  c    c    c        c  u 
5'  gccga cc uucg cggu gcgcguuc cc u
    ||||| || |||| |||| |||||||| ||  
3'  uggcu gg aagc gccg cgcgcgag gg g
   g     a  u    u    c        u  c 
Get sequence
Deep sequencing
27813 reads, 18.1 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
1A: 15633879-15633944 [-]
intergenic
Database links

Mature sequence tae-miR5384-3p

Accession MIMAT0035797
Sequence

38 - 

ugagcgcgccgccgucgaaug

 - 58

Get sequence
Deep sequencing1314 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).