Stem-loop sequence tae-MIR397

AccessionMI0030405 (change log)
DescriptionTriticum aestivum miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

12 open access papers mention tae-MIR397
(33 sentences)

Stem-loop
   c   a  g  c     a           a       -   -ua   c 
5'  gca ag ug cauug gugcagcguug ugaaccg ucc   cuc u
    ||| || || ||||| ||||||||||| ||||||| |||   |||  
3'  cgu uc gc guaac cacgucgcggc acuuggc agg   gag c
   -   c  g  a     a           c       g   ccg   c 
Get sequence
Deep sequencing
82162 reads, 273 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6A: 120354266-120354358 [-]
intergenic
Database links

Mature sequence tae-miR397-5p

Accession MIMAT0035795
Sequence

63 - 

ucaccggcgcugcacacaaug

 - 83

Get sequence
Deep sequencing17152 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).