Stem-loop sequence tae-MIR9674a

AccessionMI0030403
DescriptionTriticum aestivum miR9674a stem-loop
Gene family MIPF0001917; MIR9674
Stem-loop
   aau               u          -auucaac      u 
5'    uuguccauagcauca ccauccuacc        ggcggc g
      ||||||||||||||| ||||||||||        ||||||  
3'    gauagguaucguggu gguaggaugg        ccgucg c
   uuc               c          guggccac      u 
Get sequence
Deep sequencing
14673 reads, 1.16e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence tae-miR9674a-5p

Accession MIMAT0035793
Sequence

13 - 

gcaucauccauccuaccauuc

 - 33

Get sequence
Deep sequencing3860 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).