Stem-loop sequence tae-MIR9674a

AccessionMI0030403 (change log)
DescriptionTriticum aestivum miR9674a stem-loop
Gene family MIPF0001917; MIR9674
Stem-loop
   aau               u          -auucaac      u 
5'    uuguccauagcauca ccauccuacc        ggcggc g
      ||||||||||||||| ||||||||||        ||||||  
3'    gauagguaucguggu gguaggaugg        ccgucg c
   uuc               c          guggccac      u 
Get sequence
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9674a-5p

Accession MIMAT0035793
Sequence

13 - 

gcaucauccauccuaccauuc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).