Stem-loop sequence tae-MIR2275

AccessionMI0030387 (change log)
DescriptionTriticum aestivum miR2275 stem-loop
Gene family MIPF0000797; MIR2275
Literature search

2 open access papers mention tae-MIR2275
(27 sentences)

Stem-loop
   --aauuuu     a    uu    -       u gg          acc   g g      --             c     u            -ua   c  acacugaguguuagcuacaacaagugauaguu 
5'         ggcag ugaa  ugag uguugga g  accaaaucuu   gcc g uguggc  aagauuugguuuc uccaa aucuuauguuca   ugu ag                                g
           ||||| ||||  |||| ||||||| |  ||||||||||   ||| | ||||||  ||||||||||||| ||||| ||||||||||||   ||| ||                                 
3'         cuguc acuu  gcuc auaaccu c  ugguuuagaa   cgg u auaucg  uucuaaaccaagg agguu uagaguguaagu   acg uc                                g
   aguagucc     a    cu    u       c uu          -ca   - g      ac             u     -            cga   c  caaaccaagaacucuguccggguccacaggua 
Get sequence
Deep sequencing
331 reads, 0 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR2275-3p

Accession MIMAT0035777
Sequence

224 - 

uuugguuuccuccaauaucucg

 - 245

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).