Stem-loop sequence tae-MIR9659

AccessionMI0030377 (change log)
DescriptionTriticum aestivum miR9659 stem-loop
Literature search

3 open access papers mention tae-MIR9659
(5 sentences)

Stem-loop
   -----u        ag  ggg          -   a        a              aa uc 
5'       ccaggccu  uu   guggaugcug gga aacuauug acuagauaaguuac  c  a
         ||||||||  ||   |||||||||| ||| |||||||| ||||||||||||||  |  u
3'       gguccggg  aa   caccuacggc cuu uugguaac uggucuguucaaug  g  c
   ccuauc        --  --a          a   g        c              aa cu 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9659-3p

Accession MIMAT0035767
Sequence

80 - 

uccaaugguuguucacggcauc

 - 101

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).