Stem-loop sequence tae-MIR9657a

AccessionMI0030375 (change log)
DescriptionTriticum aestivum miR9657a stem-loop
Gene family MIPF0001955; MIR9657
Literature search

1 open access papers mention tae-MIR9657a
(2 sentences)

Stem-loop
   g    -c  g u       c  ga     u   u   ga 
5'  cgug  cg c ccguucg cg  gaagc uac gcg  c
    ||||  || | ||||||| ||  ||||| ||| |||   
3'  gcac  gc g ggcaagc gc  cuucg gug cgc  c
   -    ca  g u       u  uc     u   c   aa 
Get sequence
Deep sequencing
55191 reads, 235 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3B: 720238412-720238489 [-]
intergenic
Database links

Mature sequence tae-miR9657a-3p

Accession MIMAT0035765
Sequence

48 - 

ugugcuuccucgucgaacggu

 - 68

Get sequence
Deep sequencing30123 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).