Stem-loop sequence tae-MIR9654a

AccessionMI0030371 (change log)
DescriptionTriticum aestivum miR9654a stem-loop
Gene family MIPF0001980; MIR9654
Literature search

2 open access papers mention tae-MIR9654a
(15 sentences)

Stem-loop
   -   ac                    g        g           gga  u 
5'  ugc  guugguucgcuucaagccuu uggaauag guagacugcau   gc a
    |||  |||||||||||||||||||| |||||||| |||||||||||   || u
3'  acg  caauuaagcgaaguucggaa gucuuauc cauuugacgug   cg g
   u   au                    a        a           --a  u 
Get sequence
Deep sequencing
5694 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3B: 773196382-773196487 [-]
intergenic
Database links

Mature sequence tae-miR9654a-3p

Accession MIMAT0035761
Sequence

75 - 

uucugaaaggcuugaagcgaau

 - 96

Get sequence
Deep sequencing4523 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).