Stem-loop sequence tae-MIR9653a

AccessionMI0030370 (change log)
DescriptionTriticum aestivum miR9653 stem-loop
Literature search

2 open access papers mention tae-MIR9653a
(14 sentences)

Stem-loop
   --c   c   u    uc   -                   u      c 
5'    cau gcu uggu  cca ggccauggccaaggucucg gagguu g
      ||| ||| ||||  ||| ||||||||||||||||||| |||||| c
3'    gua cgg accg  ggu ccgguaccgguuucagagu uuccag g
   guu   -   u    gu   a                   -      u 
Get sequence
Deep sequencing
14980 reads, 14.7 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9653a-3p

Accession MIMAT0035760
Sequence

54 - 

uuugagacuuuggccauggcc

 - 74

Get sequence
Deep sequencing484 reads, 103 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).