Stem-loop sequence tae-MIR1122b

AccessionMI0030368 (change log)
DescriptionTriticum aestivum miR1122b stem-loop
Literature search

9 open access papers mention tae-MIR1122b
(35 sentences)

Stem-loop
   uua                 a                a          caaaa  c        guauauggacauauuuuag 
5'    uacucccucuguuccua auguaagucuuuuuag gauuucacug     ua auacggau                   a
      ||||||||||||||||| |||||||||||||||| ||||||||||     || ||||||||                    
3'    augagggaggcaaggau uauauucagaaaaauc cuaaagugau     au uaugccua                   g
   uaa                 g                c          accug  c        guuuuacgcacuuagauau 
Get sequence
Deep sequencing
118257 reads, 282 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
5D: 123186454-123186621 [+]
intergenic
Database links

Mature sequence tae-miR1122b-3p

Accession MIMAT0035757
Sequence

138 - 

agacuuauauguaggaacgga

 - 158

Get sequence
Deep sequencing90438 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).