Stem-loop sequence rno-mir-15a

AccessionMI0030352 (change log)
DescriptionRattus norvegicus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -     gaguaaa ua        ua          ga  u 
5'  ccuug       g  gcagcaca  augguuugug  uu u
    |||||       |  ||||||||  ||||||||||  || g
3'  ggaac       c  cgucgugu  uaccggacgu  aa a
   a     -auaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
30406 reads, 226 reads per million, 39 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rno-miR-15a-5p

Accession MIMAT0035728
Sequence

14 - 

uagcagcacauaaugguuu

 - 32

Get sequence
Deep sequencing30384 reads, 39 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence rno-miR-15a-3p

Accession MIMAT0035729
Sequence

52 - 

aggccauauugugcugccuca

 - 72

Get sequence
Deep sequencing21 reads, 14 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).