Stem-loop sequence mmu-mir-935

AccessionMI0030346 (change log)
DescriptionMus musculus miR-935 stem-loop
Gene family MIPF0000606; mir-935
Literature search

1 open access papers mention mmu-mir-935
(1 sentences)

Stem-loop
        c  c    g    a             ccc  c   caucc 
5' ggcgg gg gcgg cggc guggcgggagcgg   cu ggc     u
   ||||| || |||| |||| |||||||||||||   || |||      
3' ucgcc cu cgcc gccg caucgccuucgcc   ga ccg     c
        -  -    -    c             auu  c   ucugc 
Get sequence
Deep sequencing
2525 reads, 1.45 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3415066-3415156 [+]
sense
OTTMUST00000116707 ; Cacng8-001; 3'UTR (exon 6)
ENSMUST00000092351 ; Cacng8-201; 3'UTR (exon 4)
ENSMUST00000182222 ; Cacng8-001; 3'UTR (exon 6)
Database links

Mature sequence mmu-miR-935

Accession MIMAT0035718
Sequence

55 - 

cccaguuaccgcuuccgcuaccgc

 - 78

Get sequence
Deep sequencing2479 reads, 65 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Database links
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).