Stem-loop sequence mmu-mir-3618

AccessionMI0030345 (change log)
DescriptionMus musculus miR-3618 stem-loop
Gene family MIPF0001710; mir-3618
Literature search

3 open access papers mention mmu-mir-3618
(7 sentences)

Stem-loop
          ag        ga   c  a    ug       gguu 
5' uaagcug  ugcauugu  uuu ca uaau  aggcagu    c
   |||||||  ||||||||  ||| || ||||  |||||||     
3' guucgac  guguaacg  aaa gu auua  ucugucg    u
          cg        ag   a  a    ca       aaaa 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 18284550-18284637 [-]
sense
OTTMUST00000057894 ; Dgcr8-003; exon 1
OTTMUST00000057892 ; Dgcr8-001; 5'UTR (exon 2)
OTTMUST00000057893 ; Dgcr8-002; 5'UTR (exon 3)
ENSMUST00000128856 ; Dgcr8-003; exon 1
ENSMUST00000009321 ; Dgcr8-001; 5'UTR (exon 2)
ENSMUST00000115633 ; Dgcr8-002; 5'UTR (exon 3)
Clustered miRNAs
< 10kb from mmu-mir-3618
mmu-mir-3618chr16: 18284550-18284637 [-]
mmu-mir-1306chr16: 18284239-18284317 [-]
Database links

Mature sequence mmu-miR-3618-5p

Accession MIMAT0035716
Sequence

15 - 

ugugauuuccaauaauugaggc

 - 36

Get sequence
Deep sequencing12 reads, 8 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence mmu-miR-3618-3p

Accession MIMAT0035717
Sequence

55 - 

cuacauuaaugaaaagagcaau

 - 76

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).