Stem-loop sequence mmu-mir-3552

AccessionMI0030344 (change log)
DescriptionMus musculus miR-3552 stem-loop
Gene family MIPF0002093; mir-3552
Stem-loop
   -    -      ----gc     caa   ug -agg      u    ----   cag 
5'  ugug aaucca      ugguu   ggc  c    cccacu cccu    ugg   a
    |||| ||||||      |||||   |||  |    |||||| ||||    |||   u
3'  acau uuaggu      accaa   ccg  g    ggguga ggga    acc   u
   u    a      aaaacu     auc   gu aaag      -    cuuu   uuu 
Get sequence
Deep sequencing
99 reads, 0 reads per million, 14 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 146999405-146999509 [+]
sense
OTTMUST00000045550 ; Htr2c-004; intron 2
OTTMUST00000045548 ; Htr2c-002; intron 2
OTTMUST00000045549 ; Htr2c-003; intron 2
OTTMUST00000045553 ; Htr2c-007; intron 2
OTTMUST00000045552 ; Htr2c-006; intron 2
OTTMUST00000045515 ; Htr2c-001; intron 3
ENSMUST00000112831 ; Htr2c-006; intron 2
ENSMUST00000134368 ; Htr2c-007; intron 2
ENSMUST00000156697 ; Htr2c-003; intron 2
ENSMUST00000036303 ; Htr2c-002; intron 2
ENSMUST00000131999 ; Htr2c-004; intron 2
ENSMUST00000096299 ; Htr2c-001; intron 3
Clustered miRNAs
< 10kb from mmu-mir-3552
mmu-mir-3552chrX: 146999405-146999509 [+]
mmu-mir-764chrX: 147002259-147002366 [+]
Database links

Mature sequence mmu-miR-3552

Accession MIMAT0035715
Sequence

20 - 

aggcugcaggcccacuucccu

 - 40

Get sequence
Deep sequencing96 reads, 11 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Database links
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).