Stem-loop sequence pbv-mir-9650

AccessionMI0030340 (change log)
DescriptionPython bivittatus miR-9650 stem-loop
Stem-loop
   -   u      u     ug   cau    u     g  g 
5'  uca guauau cacag  cau   ggga augua uu c
    ||| |||||| |||||  |||   |||| ||||| || u
3'  agu cguaug guguc  gua   uccu uacau aa a
   g   c      u     gu   cuu    u     a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE960999.1: 18240-18319 [-]
intergenic
Database links

Mature sequence pbv-miR-9650-5p

Accession MIMAT0039096
Sequence

14 - 

cagugcaucaugggauaugua

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-9650-3p

Accession MIMAT0039097
Sequence

48 - 

cauuuccuuucaugugcugug

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).