Stem-loop sequence pbv-mir-5420

AccessionMI0030339 (change log)
DescriptionPython bivittatus miR-5420 stem-loop
Stem-loop
   a    -  -      ug        -   -         uuuuuu 
5'  cuga cu gagccu  cccagaca ugg gcacuuuuc      u
    |||| || ||||||  |||||||| ||| |||||||||       
3'  gacu gg cucgga  ggguuugu acu cgugaaagg      c
   g    u  u      gu        u   u         ucuaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954489.1: 53530-53617 [+]
intergenic
Database links

Mature sequence pbv-miR-5420-3p

Accession MIMAT0039095
Sequence

52 - 

aaagugcuucauuguuugggu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).