Stem-loop sequence pbv-mir-3618

AccessionMI0030338 (change log)
DescriptionPython bivittatus miR-3618 stem-loop
Stem-loop
   -  a        ga   c  g    -  a      gauu 
5'  ga ugcauugu  uuu ca uaau ug gacagu    c
    || ||||||||  ||| || |||| || ||||||     
3'  cu auguaaca  aaa gu auua ac cugucg    u
   a  g        ag   a  a    c  -      aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953903.1: 108815-108891 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-3618
pbv-mir-3618KE953903.1: 108815-108891 [+]
pbv-mir-1306KE953903.1: 109138-109225 [+]
Database links

Mature sequence pbv-miR-3618-5p

Accession MIMAT0039094
Sequence

11 - 

ugauuuccaguaauugagacagu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).