Stem-loop sequence pbv-mir-1388

AccessionMI0030328 (change log)
DescriptionPython bivittatus miR-1388 stem-loop
Stem-loop
   aagcu             a  a   u ua        a  -  gaaa 
5'      gaggaguguuuca gg cug c  accugaga ug gu    c
        ||||||||||||| || ||| |  |||||||| || ||     
3'      uuccuugcagagu cc gac g  uggacucu ac cg    a
   ---uc             a  c   u cc        a  u  uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954591.1: 217173-217264 [-]
intergenic
Database links

Mature sequence pbv-miR-1388-5p

Accession MIMAT0039077
Sequence

19 - 

aggacugucuaaccugagaaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-1388-3p

Accession MIMAT0039078
Sequence

57 - 

aaucucagguccgucagcccaug

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).