Stem-loop sequence pbv-mir-1306

AccessionMI0030326 (change log)
DescriptionPython bivittatus miR-1306 stem-loop
Stem-loop
   ----a   acag  uc       uccccu  a        gug  gc 
5'      uga    cc  caccacc      gc aacgucca   ac  a
        |||    ||  |||||||      || ||||||||   ||   
3'      acu    gg  guggugg      cg uugcaggu   ug  g
   cauag   gaca  ua       ---ucu  g        -aa  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953903.1: 109138-109225 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-1306
pbv-mir-3618KE953903.1: 108815-108891 [+]
pbv-mir-1306KE953903.1: 109138-109225 [+]
Database links

Mature sequence pbv-miR-1306-3p

Accession MIMAT0039074
Sequence

52 - 

uggacguuggcucuggugguga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).