Stem-loop sequence pbv-mir-490

AccessionMI0030319 (change log)
DescriptionPython bivittatus miR-490 stem-loop
Stem-loop
   --a   uc  ga       c      --         g   caagauu 
5'    ugu  au  uucgaca caugga  ucuccaggu ggu       a
      |||  ||  ||||||| ||||||  ||||||||| |||       u
3'    aca  ug  gaguugu guaccu  ggaggucca cca       a
   cga   cu  uc       c      ca         a   caaagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954944.1: 24235-24329 [-]
intergenic
Database links

Mature sequence pbv-miR-490-5p

Accession MIMAT0039063
Sequence

18 - 

ccauggaucuccagguggguc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-490-3p

Accession MIMAT0039064
Sequence

56 - 

ccaaccuggaggacuccaugcug

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).