Stem-loop sequence pbv-mir-489

AccessionMI0030318 (change log)
DescriptionPython bivittatus miR-489 stem-loop
Stem-loop
   -   a    ---    ug          u  c      ua    ua 
5'  gug uggc   uugg  gucguaugua ga gucauu  cuug  c
    ||| ||||   ||||  |||||||||| || ||||||  ||||   
3'  uac accg   aauc  cggcauguau cu caguga  ggau  u
   g   -    uca    gu          u  a      --    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954238.1: 44117-44203 [-]
intergenic
Database links

Mature sequence pbv-miR-489-3p

Accession MIMAT0039062
Sequence

52 - 

gugacaucuuauguacggcugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).