Stem-loop sequence pbv-mir-456

AccessionMI0030316 (change log)
DescriptionPython bivittatus miR-456 stem-loop
Stem-loop
   u   u       c    g     uc       acau ug    c 
5'  gug augugug gcag caucu  ucagccu    g  gauu u
    ||| ||||||| |||| |||||  |||||||    |  ||||  
3'  uac uacauac uguu guaga  ggucgga    c  cuaa u
   c   u       -    g     uu       ---- gu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953008.1: 414046-414130 [+]
intergenic
Database links

Mature sequence pbv-miR-456-5p

Accession MIMAT0039059
Sequence

14 - 

gcaggcaucuucucagccuac

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-456-3p

Accession MIMAT0039060
Sequence

54 - 

caggcugguuagaugguuguc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).