Stem-loop sequence pbv-mir-454

AccessionMI0030314 (change log)
DescriptionPython bivittatus miR-454 stem-loop
Stem-loop
   -    u  a       ---         cu     -ucu  a 
5'  agga aa acccuau   caauauugc  cugcu    uc c
    |||| || |||||||   |||||||||  |||||    ||  
3'  uucu uu ugggaua   guuauaacg  gauga    gg u
   u    u  c       auc         -u     uucu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953167.1: 505144-505223 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-454
pbv-mir-454KE953167.1: 505144-505223 [+]
pbv-mir-130bKE953167.1: 507018-507101 [+]
Database links

Mature sequence pbv-miR-454-3p

Accession MIMAT0039056
Sequence

49 - 

uagugcaauauugcuaauag

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).