Stem-loop sequence pbv-mir-375

AccessionMI0030306 (change log)
DescriptionPython bivittatus miR-375 stem-loop
Stem-loop
   -gc  ua             c   u      cc   c       c ga 
5'    ac  gcugggcuugccu gcg cgagcc  acg acaagac u  c
      ||  ||||||||||||| ||| ||||||  ||| ||||||| |  g
3'    ug  cgaccuggacgga ugc gcucgg  ugc uguuuug a  u
   guc  uc             u   -      cu   u       u ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE952971.1: 1095231-1095327 [-]
intergenic
Database links

Mature sequence pbv-miR-375-3p

Accession MIMAT0039045
Sequence

57 - 

uuuguucguucggcucgcguua

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).