Stem-loop sequence pbv-mir-365-2

AccessionMI0030305 (change log)
DescriptionPython bivittatus miR-365-2 stem-loop
Stem-loop
   aa   a        ac   c       -----    u   u 
5'   gaa aaugaggg  uuu aggggca     gcug guu u
     ||| ||||||||  ||| |||||||     |||| ||| a
3'   cuu uuauuccu  aaa uccccgu     ugac caa c
   --   g        aa   -       aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE956678.1: 59930-60006 [-]
intergenic
Database links

Mature sequence pbv-miR-365-3p

Accession MIMAT0039044
Sequence

52 - 

aaugccccuaaaaauccuua

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).