Stem-loop sequence pbv-mir-301b

AccessionMI0030301 (change log)
DescriptionPython bivittatus miR-301b stem-loop
Stem-loop
   --cu          cug   c         ---      a   uu  c 
5'     gcuggaaccg   gcu ugacaaugu   ugcacu cug  uu a
       ||||||||||   ||| |||||||||   |||||| |||  ||  
3'     ugaucuuggu   cga acuguuaua   acguga gau  aa c
   gucc          uua   a         aua      c   uu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953167.1: 488648-488740 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-301b
pbv-mir-130cKE953167.1: 486584-486677 [+]
pbv-mir-301bKE953167.1: 488648-488740 [+]
Database links

Mature sequence pbv-miR-301b-3p

Accession MIMAT0039040
Sequence

54 - 

cagugcaauaauauugucaaagc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).