Stem-loop sequence pbv-mir-218-1

AccessionMI0030292 (change log)
DescriptionPython bivittatus miR-218-1 stem-loop
Stem-loop
   ----   a   u      u         cu        -ggu   ga 
5'     gcg gau uucugu gugcuugau  aaccaugu    ugu  g
       ||| ||| |||||| |||||||||  ||||||||    |||  g
3'     cgc cug aaggua cacgaacug  uugguaca    gcg  u
   ucga   a   c      c         uc        aaau   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953911.1: 123602-123693 [-]
intergenic
Database links

Mature sequence pbv-miR-218-5p

Accession MIMAT0039027
Sequence

14 - 

uugugcuugaucuaaccaugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-218-3p

Accession MIMAT0039028
Sequence

53 - 

aaacaugguucugucaagcacc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).