Stem-loop sequence pbv-mir-216b

AccessionMI0030290 (change log)
DescriptionPython bivittatus miR-216b stem-loop
Stem-loop
   ggu   ag  a       -    a       a  c  a     ---  u  u 
5'    ccc  uc cagauug agaa ucucugc gg aa uguga   ug ca g
      |||  || ||||||| |||| ||||||| || || |||||   || ||  
3'    ggg  ag gucuaac ucuu ggagaug cc uu acacu   ac gu a
   --c   --  -       g    -       a  a  g     cua  -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953947.1: 188143-188237 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-216b
pbv-mir-216bKE953947.1: 188143-188237 [+]
pbv-mir-216aKE953947.1: 195072-195162 [+]
Database links

Mature sequence pbv-miR-216b-5p

Accession MIMAT0039024
Sequence

21 - 

aaaucucugcaggcaaauguga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-216b-3p

Accession MIMAT0039025
Sequence

61 - 

acaguuaccaguagagguucu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).